HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim-Schulze, S. Articles by Suciu-Foca, N. Search for Related Content PubMed PubMed Citation Articles by Kim-Schulze, S. Articles by Suciu-Foca, N. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene

Recombinant Ig-Like Transcript 3-Fc Modulates T Cell Responses via Induction of Th Anergy and Differentiation of CD8⁺ T Suppressor Cells¹

Department of Pathology, Columbia University, New York, NY 10032

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The Ig-like transcript (ILT)3 is crucial to the tolerogenic activity acquired by dendritic cells exposed to allospecific T suppressor (Ts) cells. We have explored the immunomodulatory property of the extracellular region of ILT3 using a cytoplasmic deletion mutant of ILT3 (ILT3), expressed as membrane-bound ILT3 on KG1 cells, and a rILT3-Fc fusion protein. We found that both membrane-bound and soluble ILT3 inhibited T cell proliferation in primary and secondary MLC inducing anergy in CD4⁺ Th cells and suppressing the differentiation of IFN--producing CD8⁺ CTL. Furthermore, membrane-bound and soluble ILT3 induced the differentiation of CD8⁺ FOXP3⁺ Ts cells in primary 7-day MLC. The suppressive activity of these CD8⁺ Ts cells is alloantigen specific and mediated by their capacity to induce the up-regulation of ILT3 and down-regulation of costimulatory molecules such as CD86 in APC from the stimulator used for priming, but not on control HLA-mismatched APC. Our finding that ILT3-Fc has potent immunosuppressive activity in vitro and that it acts on T cells only upon activation suggests the possibility that this agent may be of use for specific suppression of the immune response in autoimmunity or transplantation.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Increasing evidence demonstrates the immunosuppressive potential of CD4⁺ regulatory T cells (Treg)⁴ suggesting that they may be of therapeutic value (reviewed in Refs.1, 2, 3). Naturally arising Treg express constitutively CD25, the IL-2R chain, and high levels of FOXP3, the X-chromosome-encoded forkhead transcription factor (1, 2, 3). Although Treg do not proliferate in vitro or produce IL-2 after TCR cross-linking, they are capable of inhibiting proliferative responses and cytokine production by effector T cells through a still unknown mechanism (2). This inhibitory capacity, however, is not Ag-specific or MHC-restricted and, thus, in the clinical setting of transplantation or autoimmune diseases, Tregs may cause nonspecific immunosuppression, a drawback of currently used iatrogenic therapy (2, 3, 4).

Alloantigen-specific T suppressors (Ts) can be generated, however, both in vitro and in vivo by chronic antigenic stimulation (3, 5, 6, 7, 8). In previous studies, we demonstrated that multiple in vitro stimulation of human T cells with allogeneic APC results in the differentiation of CD8⁺CD28^– T cells, which are MHC class I-restricted and suppress Ag-specific CD4⁺ Th cell responses, inhibiting their capacity to produce IL-2 and preventing up-regulation of CD40L (9, 10). We further showed that CD8⁺CD28^– alloantigen-specific Ts express FOXP3 and induce the up-regulation of Ig-like transcript (ILT)3 and ILT4 on monocytes, dendritic cells (DC), and endothelial cells (EC), rendering them tolerogenic (11, 12). Tolerogenic ILT3^highILT4^high DC induce anergy in alloreactive CD4⁺CD45RO⁺CD25⁺ T cells converting these cells into Tregs which, in turn, continue the cascade of suppression by tolerizing other DC (7).

ILT3 (also known as CD85K, LIR5) and ILT4 are members of the Ig superfamily, which are selectively expressed by professional APC such as monocytes, macrophages, and DC (13, 15), and nonprofessional APC, such as EC (12). Similar to other members of the ILT family (ILT2 and ILT5), ILT3 and ILT4 have extracellular Ig-like domains, responsible for ligand binding at the cell surface, and a long cytoplasmic tail containing ITIM, which recruit inhibitory phosphatases and transduce a negative signal into the cell (13, 14, 15, 16).

Treatment of human DC and EC with IL-10 and/or IFN- also induces the up-regulation of ILT3 and ILT4 and renders these cells capable of inhibiting the proliferation of allogeneic T cells (7, 11, 12, 17). The crucial role of ILT3 and ILT4 in the induction of T cell unresponsiveness was documented by overexpressing these receptors in the myelomonocytic cell line KG1. ILT3- or ILT4-transfected KG1 cells induced anergy in unprimed or KG1-primed allogeneic T cells whereas mAbs to ILT3 and ILT4 blocked their inhibitory effect on T cell proliferation (11).

The ligand of ILT3 is unknown and no ortholog of this receptor has been identified in rodents. ILT4 binds to HLA class I molecules (14, 17, 18, 19) and its murine homolog was shown to be the paired Ig-like receptor (PIR)-B (20, 21). Using an experimental model of chronic antigenic stimulation of recipient rats with UVB-irradiated blood from their donor, we demonstrated that CD8⁺FOXP3⁺ Ts cells mediate tolerance to allogeneic heart transplants, inducing PIR-B in donor DC and EC and rendering the graft resistant to rejection (8).

Based on the finding that these Ig-like receptors mediate the induction of tolerance, we have explored the effect of membrane and soluble ILT3 (ILT3-Fc) on alloactivated human T cells. We now report that membrane-bound and soluble ILT3 inhibit the generation of T cells with cytotoxic or effector function and induce the differentiation of Ts cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Construction and expression of ILT3 and the ILT3 mutant

The generation of the KG1.ILT3 cell line, which is transfected with full-length ILT3, and of KG1.MIG, transfected with empty vector, has been previously described (11). Deletion of the ITIM-containing cytoplasmic region of ILT3 was accomplished by PCR amplification using the following primers: 5' primer CCATGATATCAGGAGACGCCATGATCCCCA and 3' primer ATGTAGCGGCCGCGTTTTCTCCCTGGACGTCA. The pcDNA4-ILT3 plasmid containing a full-length cDNA of ILT3 was used as template. PCR conditions were as follows: 5 min 94°C; 30 cycles (30 s 94°C, 1 min 68°C, 1 min 72°C); 7 min 72°C. The PCR product was purified using a PCR purification kit (Qiagen) and subcloned into the EcoRV and NotI sites of the expression vector pcDNA4/TO/myc-His in frame with a c-myc-His epitope (Invitrogen Life Technologies). The resulting ILT3 deletion mutant, ILT3 (M1-N328), encodes a protein which contains the putative leader peptide, the extracellular and transmembrane domains, and a stretch of 48 aa of the cytoplasmic domain of ILT3 followed by a C-terminal myc-His tag. The ILT3 insert was subcloned into the BglII site of retroviral vector MIG (MSCV-IRES-GFP) and the resulting construct was confirmed by sequencing. ILT3 was overexpressed in KG1 cells by retroviral transduction (11). Transfectants were sorted for GFP expression by flow cytometry and cultured in complete medium. The stable ILT3-transfected cell line is referred to hereafter as KG1.ILT3.

Construction of a soluble form of ILT3

The extracellular domain of ILT3 fused to the Fc region of human IgG1 was integrated into the mammalian expression vector pcDNA3 (Invitrogen Life Technologies). The human IgG1 H chain C region, containing the hinge region and the CH2 and CH3 sequences, was isolated with H chain-specific primers by PCR amplification of cDNA from the RNA of human spleen. H chain-specific primers: (5'primer TCGTCGACAAAACTCACACATGCC and 3' primer TTGGCGGCCGCCGCACTCATTTAC) were designed so that the resulting amplified fragment was flanked by a 5' SalI and a 3' NotI restriction sites. The extracellular 237-aa sequence of mature ILT3, preceded by the ILT3 signal sequence, was isolated by PCR amplification of pCDNA4-ILT3. ILT3-specific primers (5'primer GGATCCGGAGACGCCATGATCCCCA and 3'primer GTCGACCCAGTGCCTTCTCAGACCAC) were designed so that the amplified fragment was flanked by a 5' KpnI and a 3' SalI restriction sites. The two amplified fragments were cloned in the pGEM-T vector (Promega), and the correct inserts were verified by sequencing. The KpnI/SalI extracellular domain of ILT3 was then fused to the SalI/NotI Fc region of human IgG1 by sequential cloning in the pBluescript KS vector (Stratagene). To abolish binding to the FcRs, a mutation was introduced in the N-linked glycosylation site of the Fc domain (N77>G). Lastly, the KpnI/NotI sequence encoding the ILT3-Fc chimeric protein was cloned into the pcDNA3 (Invitrogen Life Technologies) mammalian expression vector.

Expression and purification of ILT3-Fc fusion protein

Expression vector pcDNA3 ILT3-Fc was linearized using BglII for transfection into CHO-S cells (Invitrogen Life Technologies). A stable transfected CHO-S cell line, expressing ILT3-Fc, was generated by transfecting 3 x 10⁵ cells with 5 µg of linear plasmid by nucleofection (Amaxa). Transfected cells were selected in serum-free medium (CHO-S-SFM II) containing 1500 µg/ml geneticin (Invitrogen Life Technologies) and screened for expression of ILT3-Fc by RT-PCR and immunoblotting. Homogenous cell populations were obtained by limiting dilution and clones with high expression of ILT3-Fc were selected. ILT3-Fc fusion protein was purified from the supernatant of the selected clones using a recombinant protein A-Sepharose fast flow column (Pierce Biotechnology), followed by dialysis against PBS and 0.22-µm filter sterilization. Purified protein was stored at –20°C before use.

Immunoblot analysis

Cells were washed, lysed, and proteins were extracted. Protein preparations were brought to equal concentrations, separated on SDS-PAGE gels and then transferred to nitrocellulose and probed with specific mAb: anti-myc (clone 9E10; Sigma-Aldrich), anti-human-Fc (Southern Biotechnology Associates), anti-FOXP3 mAb (clone hFOXY; eBioscience), and anti-phosphotyrosine rabbit polyclonal Ab (Santa Cruz Biotechnology). Finally, the membranes were treated with HRP-conjugated secondary Abs and films were developed by the ECL method (Amersham Biosciences). To investigate the interaction of SHP-1 with different ILT3 constructs, cell extracts were immunoprecipitated using anti-SHP-1 antiserum (Santa Cruz Biotechnology) and protein G followed by Western blot analysis with anti-myc Ab, as described above. Cells were pretreated with pervanadate (PV; 100 µM) for 30 min at 37°C where indicated. For cross-linking experiments, mAb anti-HLA-DR (BD Biosciences), anti-ILT3, and F(ab')₂ goat anti-mouse IgG (Sigma-Aldrich) were used.

T cell isolation and culture

PBMC from healthy blood donors were separated from buffy coats by density gradient centrifugation. CD3⁺ T cells were obtained by selective depletion of CD14, CD19, CD56, CD16, CD36, CD123, and glycophorin A-positive cells using CD3 isolation kits (Miltenyi Biotec) according to the manufacturer’s instructions. CD25⁺ T cells were depleted from all CD3⁺ T cell suspensions used in functional assays. CD4⁺ or CD8⁺ T cells were magnetically sorted from CD3⁺ T cells to a purity of 95–98% using CD4 or CD8 isolation kits (Miltenyi Biotec). All cell cultures were performed in complete medium (RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, and 50 mg/L gentamicin from Mediatech).

Proliferation assays

Primary MLC were performed using responding T cells (5 x 10⁴ cells/well) and allogeneic-stimulating cells (2.5 x 10⁴ cells/well) irradiated with 3000 rad. CD2-depleted APC or the myelomonocytic cells lines KG1 (American Type Culture Collection), KG1.MIG, KG1.ILT3 (11), or KG1.ILT3 were used as stimulating cells. Cultures were harvested on day 6. For secondary MLC, responding T cells from primary MLC were collected on day 7, washed and restimulated for 3 days with the APC used for priming or with KG1 cells, as indicated. [³H]Thymidine was added to the cultures 18 h before harvesting and incorporation was determined by scintillation spectrometry using a LKB 1250 Betaplate counter (PerkinElmer). Mean cpm of triplicate cultures and the SD from the mean were calculated. In some experiments, Ts cells were added to responding cells at various ratios. Recombinant human IL-2 (10 U/ml; R&D Systems) or anti-ILT3 mAb (5 µg/ml) (clone ZM 3.8, a gift from Dr. M. Colonna, Washington University School of Medicine, St. Louis, MO) were added to the proliferation assays as indicated. The fusion protein ILT3-Fc was used at various concentrations as indicated. Normal human IgG (Sigma-Aldrich) was used at the same concentrations in parallel control cultures.

Cytolysis assay

CD3⁺CD25^– T cells were cultured with irradiated KG1.MIG cells in the presence or absence of ILT3-Fc (50 µg/ml) or with KG1.ILT3 cells. After 7 days of incubation, CD8⁺ T cells were isolated, washed, and cultured for an additional 6 h with KG1 cells at a ratio of 10:1 (E:T). For flow cytometry studies, the cells were labeled with anti-CD8 mAb (allophycocyanin-conjugated) from BD Biosciences for gating out CD8⁺ T cells, and with Annexin V^FITC and propidium iodide (PI; BD Biosciences). Early (annexin V-positive) and late (annexin V and PI double-positive) apoptotic KG1 cells were analyzed by flow cytometry. As a control, CD8⁺ T effector cells and KG1 target cells were cultured separately and mixed at the same E:T ratio before staining. For ⁵¹Cr release assays, KG1 target cells were labeled with ⁵¹Cr (0.1 mCi/ml) at 37°C for 1 h, washed, counted, and plated at 10⁴/well in 0.1 ml of medium. CD8⁺ T cells tested as effectors were added at an E:T ratio of 10:1 in 0.1 ml of medium. For spontaneous and maximum release, 0.1 ml of medium or 0.2% Triton X-100 was added to each well. The plates were briefly spun and placed into a 37°C incubator. After 5 h, the plates were spun again and 0.1 ml of supernatant from each well was transferred to a glass tube and counted in a gamma counter (Packard Instrument). Specific lysis was determined using the formula: (100 x (experimental release – spontaneous release)/(maximum release – spontaneous release)).

ELISPOT assay for the production of IFN-, IL-2, and IL-10

ELISPOT analysis of IFN-, IL-2, and IL-10 was performed using cytokine-specific kits (BD Biosciences). Briefly, ELISPOT plates were coated overnight at 4°C with capture Ab at the recommended concentration. CD8⁺ T cells were isolated from CD3⁺CD25^– cells which had been primed for 7 days with KG1 in the presence or absence of ILT3-Fc, KG1.ILT3, or KG1.ILT3. CD8⁺ T cells (2.5 x 10⁴ cells/well) and irradiated KG1 cells (2 x 10⁵ cells/well) were plated in triplicate reactions. Plates were incubated at 37°C for 24 h. Cells were aspirated and plates were washed twice with deionized water. Wells were soaked for 3–5 min at each wash step to lyse the remaining cells. Plates were washed again with PBS containing 0.05% Tween 20 and coated with detection Ab at room temperature for 2 h. Plates were then washed and streptavidin-HRP at the dilution recommended by the manufacturer was added to each well. After 1 h of incubation at room temperature, plates were washed and developed by adding 3-amino-9-ethyl-carbasole substrate. Developed plates were dried overnight and analyzed using ImmunoSpot software (Cellular Technology).

Induction of CD8⁺ Ts cells by use of membrane-bound ILT3 or ILT3-Fc protein

CD3⁺CD25^– T cells (1 x 10⁶/ml) were cultured with irradiated allogeneic CD2-depleted PBMCs (0.5 x 10⁶/ml) in the presence or absence of ILT3-Fc protein or control human IgG (50 µg/ml) or with irradiated KG1, KG1.MIG, KG1.ILT3, or KG1.ILT3 (0.5 x 10⁶ cells/well). CD8⁺ T cells were isolated from these cultures after 7 days and tested for inhibitory activity. For suppression assays, various numbers of alloactivated CD8⁺ T cells were added to primary MLC containing autologous CD3⁺CD25^– T cells (5 x 10⁴ cells/well) and the allogeneic APC used for Ts priming (2.5 x 10⁴ cells/well). Proliferation was measured as described above.

Generation of monocyte-derived DC

Monocytes were obtained from PBMCs using a Monocyte Negative Selection kit (Dynal Biotech). Immature DC were generated by culturing monocytes for 7 days in 6-well plates at a concentration of 2 x 10⁶ cells/well with GM-CSF and IL-4 (R&D Systems). On day 7, immature DC were collected, washed and then cocultured with Ts.

Diffusion chamber experiments

CD4⁺CD25⁺ T cells (2.5 x 10⁴ cells/well) and irradiated allogeneic APC (5 x 10⁴ cells/well) were cocultured in the bottom compartment of a Transwell system (Nalge Nunc International). CD8⁺ Ts isolated from primary MLC containing ILT3-Fc (2.5 x 10⁴ cells/well) were added either to the bottom compartment or cocultured with specific APC in the top compartment of the Transwell system. After 5 days, the semipermeable membranes were removed and the proliferative response of Th cells was measured by [³H]TdR incorporation during the last 18 h of culture.

FACS analysis

Flow cytometry studies were performed on a BD Biosciences FACSCalibur instrument using five-parameter acquisition (forward scatter, side scatter, and three fluorescence channels) (BD Biosciences). The following mAbs were used: CD4-FITC, CD8-FITC, CD86-FITC, CD11c-PE, CD25-PE, CD3-CyChrome (all from BD Biosciences), and ILT3-PC5 (Coulter). For each cell surface marker, a corresponding isotype-matched Ab conjugated with the same fluorescent dye was used as a negative control. Cells were incubated with saturating concentrations of the indicated mAbs for 20 min at 4°C in PBS containing 5% FCS and 0.01% NaN₃, washed twice and analyzed by FACS using CellQuest software.

ILT3-Fc was labeled with FITC dye using the FluoReporter FITC Protein Labeling kit (Invitrogen Life Technologies). The end product, ILT3-Fc-FITC, had a concentration of 0.4 mg/ml and a degree of labeling of 3:1 molecules of dye per protein. Normal mouse IgG (Caltag Laboratories), used as a negative control for ILT3-Fc-FITC staining, was dialyzed and labeled with FITC by the same method. Cells were stained by adding 10 µl of ILT3-Fc-FITC or IgG-FITC to 100 µl of cell suspension (10⁵ cells). After 30 min of incubation at 4°C, cells were washed and analyzed.

Molecular typing of HLA class I and II

HLA genotypes of healthy blood donors were determined by PCR with sequence-specific primers using commercially available kits (One Lambda).

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Membrane-bound ILT3 induces CD4⁺ Th cell anergy and inhibits the generation of CD8⁺ cytotoxic cells

The cytoplasmic region of ILT3 contains ITIM that recruit inhibitory phosphatases, which can negatively regulate cell activation (15). The extracellular portion consists of two Ig-like domains, which presumably enclose the ILT3 ligand-binding sites involved in the interaction of APC with T lymphocytes. We engineered a construct (ILT3) that includes the extracellular and transmembrane regions but lacks the ITIM-containing cytoplasmic domain of the ILT3 receptor and is, thus, unable to deliver intracellular signals upon ligand binding. This construct was overexpressed in KG1 cells and the resulting cell line, KG1.ILT3, was used to explore the activity of membrane-bound ILT3 (Fig. 1A)

View larger version (32K): [in this window] [in a new window]   FIGURE 1. Functional analysis of KG1.ILT3 and KG1.ILT3. A, Schematic diagram of MIG retroviral expression vectors encoding full-length ILT3 and the cytoplasmic deletion mutant of ILT3 (ILT3). B, Fluorescence histograms of ILT3 and ILT3 expression on the surface of KG1.ILT3 and KG1.ILT3 (filled histograms). Untransfected KG1 is shown with a solid line. C, Analysis of ILT3/SHP-1 interaction in KG1, KG1.ILT3, and KG1.ILT3 by immunoprecipitation (IP) with anti-SHP-1 Abs and Western blot (WB) with anti-myc HRP. PV indicates pervanadate pretreatment of cells. D, Western blot analysis of protein tyrosine phosphorylation in KG1.ILT3 and KG1.ILT3 treatment with anti-HLA-DR and with or without anti-ILT3 and cross-linking mAbs.

The cytoplasmic region of ILT3 contains ITIM, which associate with SHP-1 protein tyrosine phosphatase mediating negative signaling. This association is increased upon ILT3 cross-linking with specific Abs or PV treatment (15). Immunoprecipitation experiments using the anti-SHP-1 Abs, followed by Western blot analysis using anti-myc Abs, showed constitutive interaction of the untruncated ILT3 molecule with SHP-1. This interaction was increased by treating KG1.ILT3 with PV. As expected, no interaction of SHP-1 with ILT3 was observed (Fig. 1C, middle and right panels). Cross-linking of HLA-DR and ILT3 on KG1.ILT3 cells inhibited tyrosine phosphorylation, as also shown by others (15), yet had no effect on tyrosine phosphorylation in KG1.ILT3 cells, consistent with the lack of SHP-1 recruitment (Fig. 1D).

Comparison of the ability of KG1, KG1.MIG, KG1.ILT3, and KG1.ILT3 to elicit T cell proliferation in primary and secondary MLC showed that KG1 and KG1.MIG but not KG1.ILT3 or KG1.ILT3 elicited proliferation of unprimed (Fig. 2A) or KG1-primed T cells (Fig. 2B). The allostimulatory activity of KG1.MIG, transfected with the empty vector, was consistently equal to that of KG1. In six repeat experiments, addition of ILT3 mAbs or rIL-2 to the blastogenesis assays restored T cell proliferation in response to KG1.ILT3 or KG1.ILT3. This indicates that membrane ILT3 protein is sufficient for inducing an inhibitory signal in activated T cells and that deletion of the cytoplasmic region of ILT3 does not abrogate its T cell-anergizing activity.

View larger version (33K): [in this window] [in a new window]   FIGURE 2. T cell responses to KG1, KG1.MIG, KG1.ILT3, and KG1.ILT3. Proliferative responses of: A, Unprimed CD3+ T cells; B, KG1-primed CD3+ T cells cultured with or without rIL-2 or anti-ILT3. C, Killing of KG1 target cells by CD8+ T cells primed as indicated; Annexin VPI staining. D, Percent apoptotic cells (early plus late apoptosis) from C at a 10:1 E:T ratio. E, Percent target cell lysis in 51Cr release assay at a 10:1 E:T ratio.

ILT3-Fc protein induces Th cell anergy and inhibits the generation of CTLs

Based on the finding that the extracellular domain of ILT3 inhibits T cell function even upon deletion of the cytoplasmic region, we explored the possibility of using ILT3-Fc as an immunomodulatory agent. For this, we engineered a soluble form of ILT3, which was expressed in CHO-S cells as an Fc-fusion protein (Fig. 3A). Western blot analysis of ILT3-Fc using anti-human Fc Ab, showed that its molecular masses were 50 and 90 kDa, under reducing and nonreducing SDS-PAGE conditions, respectively, indicating the dimeric nature of ILT3-Fc (Fig. 3B).

View larger version (19K): [in this window] [in a new window]   FIGURE 3. Structural and functional analysis of rILT3-Fc. A, The extracellular domain of ILT3 fused to the Fc region of human IgG1 was cloned into the mammalian expression vector pcDNA3. B, Molecular masses of ILT3-Fc as determined by SDS-PAGE under reducing and nonreducing conditions. Supernatant of nontransfected (10 µg) (lane 1) and ILT3-Fc transfected (1, 5, 10 µg) CHO-S cells was used. C, Proliferative responses of unprimed and (D) primed CD3+ T cells to allogeneic APC in the presence of different concentrations of ILT3-Fc or human IgG. E, Effect of mAb to ILT3 on ILT3-Fc-induced suppression of T cell proliferation.

Study of the capacity of ILT3-Fc to inhibit the differentiation of CTLs showed that CD8⁺ T cells primed in 7-day cultures with KG1.MIG cells, in the presence of ILT3-Fc (50 µg/ml), did not kill KG1 cells in annexin V/PI or ⁵¹Cr release CTL assays (Fig. 2, C and D). In contrast CD8⁺ T cells primed to KG1 in the presence or absence of human IgG displayed CTL function (Fig. 2E). Hence, similar to membrane-bound ILT3, soluble ILT3 inhibits the differentiation of CTL.

Membrane-bound and soluble ILT3 induce the generation of CD8⁺ FOXP3⁺ Ts

We investigated the possibility that CD8⁺ T cells allostimulated in the presence of membrane or soluble ILT3, not only lose CTL activity but also acquire suppressor function. To determine whether ILT3-Fc induces the in vitro differentiation of CD8⁺ Ts cells, we primed CD3⁺CD25^– T cells isolated from fresh peripheral blood with allogeneic APC, in the presence of ILT3-Fc or control human IgG (50 µg/ml). Increasing numbers of CD8⁺ T cells, magnetically sorted from these cultures after 7 days, were added to MLC containing unprimed CD4⁺CD25^– T cells from the same responder and APC from the original stimulator. CD8⁺ T cells primed in the presence of ILT3-Fc induced dose-dependent inhibition of T cell proliferation reaching >90% at a 1:1 ratio of primed CD8⁺ Ts to responding CD4⁺ Th cells (Fig. 4A). CD8⁺ T cells primed in control cultures containing purified human IgG induced at most 20% inhibition. In parallel cultures, we studied the capacity of KG1.ILT3 to induce the generation of CD8⁺ Ts. CD3⁺CD25^– T cells were primed for 7 days either with KG1 or KG1.ILT3 cells. At the end of the incubation time, CD8⁺ T cells were isolated and tested for their capacity to inhibit the response to KG1 of unprimed, autologous CD4⁺ T cells. CD8⁺ T cells primed to KG1.ILT3 induced dose-dependent inhibition of T cell responses to KG1, while CD8⁺ T cells primed to KG1 showed inhibitory activity (37%) only at the highest (1:1) Ts/Th cell ratio (Fig. 4B). These results were reproduced in four independent experiments which indicate that soluble ILT3 as well as membrane ILT3 induce the differentiation of CD8⁺ Ts in primary MLC.

View larger version (24K): [in this window] [in a new window]   FIGURE 4. Study of CD8+ Ts cells primed in the presence of membrane or soluble ILT3. A, CD8+ T cells stimulated in 7-day cultures with allogeneic CD2-depleted APC in the presence of ILT3-Fc or control human IgG were tested for their ability to suppress primary MLC containing autologous responding T cells and APC from the original stimulator. Various numbers of CD8+ Ts were added to a constant number of responding and stimulating cells. B, CD8+ T cells primed for 7 days to KG1.ILT3 were tested for their ability to suppress primary MLC containing autologous T cells and KG1 stimulating cells. Various numbers of CD8+ Ts were tested for suppressive activity. C, ELISPOT analysis of IFN-, IL-2, and IL-10 production. CD8+ T cells primed in 7-day MLC with KG1, KG1 + ILT3-Fc, KG1.ILT3, or KG1.ILT3 were restimulated for 24 h with KG1. Number of positive spots per well was determined. D, Diffusion chamber experiments. ILT3-induced CD8+ Ts were tested for their effect on the proliferative response of autologous CD4+ Th to allogeneic APC. Ts and Th were stimulated with allogeneic APC either mixed together or separated by a semipermeable membrane. E, Western blot analysis of FOXP3 expression in CD8+ T cells primed with CD2-depleted APC (lane 1), CD2-depleted APC plus ILT3-Fc (lane 2), KG1 (lane 3), and KG1.ILT3 (lane 4).

To further explore the possibility that ILT3-induced Ts secrete inhibitory factors, coculture experiments using semipermeable membranes, for separating CD8⁺ Ts cells from CD4⁺CD25^– Th cells were performed. CD4⁺CD25^– T cells isolated from the fresh peripheral blood of responder A were stimulated with irradiated CD2-depleted APC of individual B in the bottom compartment. ILT3-Fc-induced CD8⁺ Ts from primary MLC (A primed to B) were added to the bottom compartment or stimulated with the same APC (of B) in the top compartment. Inhibition of alloreactivity occurred only when CD8⁺ Ts, CD4⁺ Th and APC were in close contact, but not when Ts cells and Th cells were separated by a membrane, indicating that cell-to-cell interaction is required for the suppressive effect induced by CD8⁺ Ts cells to occur (Fig. 4D).

Because FOXP3 is a characteristic marker for CD4⁺ (1, 2, 3, 5) and CD8⁺ Treg cells (12, 22), we analyzed its expression in CD8⁺ T cells primed for 7 days to allogeneic APC in the presence or absence of ILT3-Fc (50 µg/ml) and in CD8⁺ T cells primed for 7 days with KG1 or KG1.ILT3. Western blot analysis of CD8⁺ T cells with suppressor activity using mAb to FOXP3 showed that both ILT3-Fc and membrane ILT3 induced high expression of FOXP3 (Fig. 4E). These data indicate that ILT3-Fc and membrane ILT3 induce the differentiation of CD8⁺ Ts with potent inhibitory activity.

Mechanism of action of ILT3-Fc-induced CD8⁺ Ts

CD8⁺ Ts generated by multiple in vitro stimulation with allogeneic APC were previously shown to act directly on APC, inducing the down-regulation of costimulatory molecules and the up-regulation of ILT3 and ILT4 (11). To determine whether CD8⁺ Ts generated by allostimulation in the presence of ILT3-Fc have a similar effect on APC, we tested their ability to modulate CD86 and ILT3 expression on DC from the donor used for priming and on control DC from an individual sharing no HLA class I Ags with the original stimulator.

CD8⁺ T cells isolated from the culture containing ILT3-Fc were able to dramatically up-regulate the expression of ILT3 on DC from the specific stimulator but not on control DC. This alloantigen-specific up-regulation of the inhibitory receptor ILT3 occurred in conjunction with the down-regulation of CD86 (Fig. 5A).

View larger version (19K): [in this window] [in a new window]   FIGURE 5. A, Flow cytometric analysis of CD86 and ILT3 expression on DC from the specific stimulator (upper panel) and HLA-mismatched control (lower panel) incubated with CD8+ Ts allostimulated in the presence of ILT3-Fc (filled histogram) or without ILT3-Fc (solid line). Dotted line represents level of expression on untreated DC. B, Flow cytometric analysis of ILT3-Fc-FITC binding to CD4+ T cells (upper panels) and CD8+ T cells (lower panels) before and 3 days after allostimulation with KG1 cells. C, Proliferative response of CD4+ T cells to CD2-depleted allogeneic APC in the presence or absence of ILT3-Fc.

The direct effect of ILT3-Fc on CD4⁺ T cells was demonstrated in experiments in which ILT3-Fc was added to cultures containing sorted CD4⁺CD25^– T cells and CD2-depleted APC from an allogeneic donor. ILT3-Fc induced 86 ± 9% inhibition at 50 µg/ml in five independent experiments while purified human IgG had no suppressive effect (Fig. 5C).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Effective priming of CD4⁺ T lymphocytes requires cell-to-cell interaction between APC and T cells. This interaction allows bidirectional costimulatory signals which activate the APC and T cells with cognate-specific TCR. TCR triggering results in up-regulation of CD40L expression on activated CD4⁺ T cells. CD40L interacts with CD40 on APC inducing them to up-regulate costimulatory molecules which, upon interaction with their counterreceptor trigger CD4 Th cell proliferation and differentiation of effector function (reviewed in Ref.2). There are numerous potentially relevant ligands whose expression is up-regulated on APC upon activation, including B7.1/B7.2 (CD80/CD86), ICOS, ICAM-1 (CD54), 4-1 BBL, OX40L, and CD70 among others. The B7.1/B7.2:CD28/CTLA-4 costimulatory pathway has received considerable attention as a regulatory point in T cell reactivity, representing attractive targets for new therapeutic strategies aimed at treatment of tumors, autoimmune diseases, and graft rejection (23, 24, 25, 26).

The differentiation of CD8⁺ CTL was shown to be contingent upon recognition of MHC class I/peptide complexes on APC, and notably DC, that have been "licensed" or conditioned by CD4⁺ Th cells via the CD40-signaling pathway. There is ample evidence that T cell "help" is required for CD8 T cell activation, maturation, proliferation, and maintenance of CTL function (27, 28, 29, 30, 31).

However, APC can also serve a tolerogenic function (reviewed in Ref.23). The role of ILT in tolerance induction has been established by the finding that allospecific CD8⁺CD28^– Ts up-regulate ILT3 and ILT4 expression on DC, rendering them tolerogenic (11). Such tolerogenic DC anergize alloreactive CD4⁺ T cells converting them into regulatory cells, which, in turn continue the cascade of suppression by tolerizing other DC (7). Similarly, alloantigen-specific CD8⁺CD28^– FOXP3⁺ Ts have been shown to induce ILT3⁺ILT4⁺ tolerogenic endothelial cells, inhibiting alloreactivity (12). Treatment of DC with IL-10 and/or IFN-, or with 1,25(OH)₂D₃ and its analogs can also induce DC which express inhibitory ILT and display tolerogenic properties in vitro and/or in vivo (7, 32, 33, 34, 35).

In the present study, we have explored the immunomodulatory property of the extracellular region of ILT3 using either ILT3-Fc or a cytoplasmic deletion mutant of ILT3, expressed as membrane-bound ILT3 on KG1 cells. We found that both membrane and soluble ILT3 inhibited CD3⁺ T cell proliferation in primary and secondary MLC inducing anergy in the responding population and suppressing the differentiation of IFN--producing CD8⁺ CTL.

The inhibitory activity of ILT3 is most likely caused by its interaction with the ILT3 ligand expressed by CD4⁺ T cells. This view is supported by the finding that ILT3-Fc: 1) binds to a relatively large percentage of CD4⁺ T cells but not of CD8⁺ T cells stimulated for 3 days with allogeneic APC and 2) inhibits the response of CD4⁺ T cells in primary MLC. It therefore appears that inhibition of CD8⁺ CTL differentiation in cultures containing ILT3-Fc is due to lack of T cell help, rather than to a direct effect on CD8⁺ T cells.

Importantly, however, CD8⁺ T cells sorted from CD3⁺-responding cells that have been allostimulated for 7 days in the presence of ILT3-Fc or ILT3 acquired suppressor function. When transferred to primary MLC, these CD8⁺ Ts inhibited T cell proliferation in a dose-related, contact-dependent, and IL-10 independent manner. The suppressive activity of these CD8⁺ Ts seems to be mediated by their capacity to induce the up-regulation of ILT3 and down-regulation of costimulatory molecules (such as CD86) in the APC used for priming. Because no such changes are induced in control APC with a different HLA phenotype, it results that the suppressive activity of CD8⁺ Ts is Ag-specific and cytokine-independent. It, therefore, appears that the inhibitory receptor ILT3 can signal both intracellularly, negatively regulating activation of APC, and extracellularly via a ligand expressed by activated T cells.

Similar to CD8⁺ Ts generated by chronic antigenic stimulation, CD8⁺ Ts induced in the presence of ILT3 express FOXP3. Although it is still unknown how FOXP3 induces suppression it is worthwhile noticing that it is expressed at high levels by Ts and Treg which act by cell-to-cell interaction (1, 2, 3, 5, 8, 12, 22), but not by those which act via inhibitory cytokines (36). This raises the possibility that Ag-specific "adaptive" Treg and naturally occurring, Ag nonspecific Treg share cell surface molecules required for T cell-T cell or T cell-APC interaction.

In contrast to ILT3-Fc which displays dose-dependent inhibitory activity and mimics the effect of membrane ILT3, soluble ILT4 was reported to contribute to enhanced T cell proliferation in response to allogeneic DC activated with LPS. This effect was suggested to result from competition between membrane ILT4, which is inhibitory, and soluble ILT4 for binding to MHC class I molecules on T cells (17).

Our finding that ILT3-Fc has potent immunosuppressive activity and that it acts on T cells only upon activation has important clinical implications. Because ILT3-Fc has no effect on resting, nonstimulated T cells it is likely to inhibit allograft rejection mediated by T cells activated via the direct or indirect pathway. Preliminary experiments performed in humanized SCID mice support this view (N. Suciu-Foca, unpublished observations).

Administration of ILT3-Fc may also attenuate the proliferation of T cells involved in aggressive autoimmune responses triggered by activated DC which cross-present immunogenic self-peptides. Attenuation of activation efficiency may result in stalled immune responses which perpetuate quiescence.

There is ample evidence from experiments performed in nonhuman primates that costimulation blockade by use of CD152 fusion proteins, such as CTLA-4 Ig, or mAbs specific for CD154 results in long-term allograft survival (37, 38, 39, 40, 41, 42, 43, 44). By analogy, soluble ILT3-Fc signaling in T lymphocytes via its ligand may interfere with the generation of effective immunity, promoting the generation of T cells with suppressive function.

Based on our present findings, we postulate that ILT3-Fc may prove to be an important agent for induction of Ag-specific tolerance. By rendering activated CD4⁺ Th cells anergic, triggering the differentiation of CD8⁺ Ts which induce tolerogenic DC (with high membrane levels of ILT3 and ILT4), ILT3-Fc may increase the arsenal of modern immunomodulatory agents.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by grants from the National Institutes of Health (NIH) AI25210-18, NIH AI55234-03, and the Interuniversitary Organ Transplantation Consortium, Rome, Italy.

² S.K.-S., L.S., and G.V. have contributed equally to the work.

³ Address correspondence and reprint requests to Dr. Nicole Suciu-Foca, Department of Pathology, Columbia University, 630 West 168 Street–P&S 14-401, New York, NY 10032. E-mail address: ns20{at}columbia.edu

⁴ Abbreviations used in this paper: Treg, regulatory T cell; Ts, T suppressor; DC, dendritic cell; EC, endothelial cell; PIR paired Ig-like receptor; ILT, Ig-like transcript; PI, propidium iodide; PV, pervanadate.

Received for publication September 12, 2005. Accepted for publication December 30, 2005.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Sakaguchi, S., N. Sakaguchi. 2005. Regulatory T cells in immunologic self-tolerance and autoimmune disease. Int. Rev. Immunol. 24: 211-226. [Medline]
2. Fontenot, J. D., A. Y. Rudensky. 2005. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat. Immunol. 6: 331-337. [Medline]
3. Bluestone, J. A.. 2005. Regulatory T-cell therapy: is it ready for the clinic?. Nat. Rev. Immunol. 5: 343-349. [Medline]
4. Mills, K. H.. 2004. Regulatory T cells: friend or foe in immunity to infection?. Nat. Rev. Immunol. 4: 841-855. [Medline]
5. Walker, M. R., B. D. Carson, G. T. Nepom, S. F. Ziegler, J. H. Buckner. 2005. De novo generation of antigen-specific CD4⁺CD25⁺ regulatory T cells from human CD4⁺CD25^– cells. Proc. Natl. Acad. Sci. USA 102: 4103-4108. [Abstract/Free Full Text]
6. Chen, T. C., S. P. Cobbold, P. J. Fairchild, H. Waldmann. 2004. Generation of anergic and regulatory T cells following prolonged exposure to a harmless antigen. J. Immunol. 172: 5900-5907. [Abstract/Free Full Text]
7. Manavalan, J. S., P. C. Rossi, G. Vlad, F. Piazza, A. Yarilina, R. Cortesini, D. Mancini, N. Suciu-Foca. 2003. High expression of ILT3 and ILT4 is a general feature of tolerogenic dendritic cells. Transplant. Immunol. 11: 245-258. [Medline]
8. Liu, J., Z. Liu, P. Witkowski, G. Vlad, J. S. Manavalan, L. Scotto, S. Kim-Schulze, R. Cortesini, M. A. Hardy, N. Suciu-Foca. 2004. Rat CD8⁺ FOXP3⁺ T suppressor cells mediate tolerance to allogeneic heart transplants, inducing PIR-B in APC and rendering the graft invulnerable to rejection. Transplant. Immunol. 13: 239-247. [Medline]
9. Liu, Z., S. Tugulea, R. Cortesini, N. Suciu-Foca. 1998. Specific suppression of T helper alloreactivity by allo-MHC class I-restricted CD8⁺CD28^– T cells. Int. Immunol. 10: 775-783. [Abstract/Free Full Text]
10. Liu, Z., S. Tugulea, R. Cortesini, S. Lederman, N. Suciu-Foca. 1999. Inhibition of CD40 signaling pathway in antigen presenting cells by T suppressor cells. Hum. Immunol. 60: 568-574. [Medline]
11. Chang, C. C., R. Ciubotariu, J. S. Manavalan, J. Yuan, A. I. Colovai, F. Piazza, S. Lederman, M. Colonna, R. Cortesini, R. Dalla-Favera, N. Suciu-Foca. 2002. Tolerization of dendritic cells by T_S cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat. Immunol. 3: 237-243. [Medline]
12. Manavalan, J. S., S. Kim-Schulze, L. Scotto, A. J. Naiyer, G. Vlad, P. C. Colombo, C. Marboe, D. Mancini, R. Cortesini, N. Suciu-Foca. 2004. Alloantigen specific CD8⁺CD28^– FOXP3⁺ T suppressor cells induce ILT3⁺ ILT4⁺ tolerogenic endothelial cells, inhibiting alloreactivity. Int. Immunol. 16: 1055-1068. [Abstract/Free Full Text]
13. Colonna, M., H. Nakajima, M. Cella. 2000. A family of inhibitory and activating Ig-like receptors that modulate function of lymphoid and myeloid cells. Semin. Immunol. 12: 121-127. [Medline]
14. Colonna, M., J. Samaridis, M. Cella, L. Angman, R. L. Allen, C. A. O’Callaghan, R. Dunbar, G. S. Ogg, V. Cerundolo, A. Rolink. 1998. Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. J. Immunol. 160: 3096-3100. [Abstract/Free Full Text]
15. Cella, M., C. Dohring, J. Samaridis, M. Dessing, M. Brockhaus, A. Lanzavecchia, M. Colonna. 1997. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J. Exp. Med. 185: 1743-1751. [Abstract/Free Full Text]
16. Ravetch, J. V., L. L. Lanier. 2000. Immune inhibitory receptors. Science 290: 84-89. [Abstract/Free Full Text]
17. Beinhauer, B. G., J. M. McBride, P. Graf, E. Pursch, M. Bongers, M. Rogy, U. Korthauer, J. E. de Vries, G. Aversa, T. Jung. 2004. Interleukin 10 regulates cell surface and soluble LIR-2 (CD85d) expression on dendritic cells resulting in T cell hyporesponsiveness in vitro. Eur. J. Immunol. 34: 74-80. [Medline]
18. Brown, D., J. Trowsdale, R. Allen. 2004. The LILR family: modulators of innate and adaptive immune pathways in health and disease. Tissue Antigens 64: 215-225. [Medline]
19. Shiroishi, M., K. Tsumoto, K. Amano, Y. Shirakihara, M. Colonna, V. M. Braud, D. S. Allan, A. Makadzange, S. Rowland-Jones, B. Willcox, et al 2003. Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Proc. Natl. Acad. Sci. USA 100: 8856-8861. [Abstract/Free Full Text]
20. Maeda, A., A. M. Scharenberg, S. Tsukada, J. B. Bolen, J. P. Kinet, T. Kurosaki. 1999. Paired immunoglobulin-like receptor B (PIR-B) inhibits BCR-induced activation of Syk and Btk by SHP-1. Oncogene 18: 2291-2297. [Medline]
21. Nakamura, A., E. Kobayashi, T. Takai. 2004. Exacerbated graft-versus-host disease in Pirb^–/– mice. Nat. Immunol. 5: 623-629. [Medline]
22. Scotto, L., A. J. Naiyer, S. Galluzzo, P. Rossi, J. S. Manavalan, S. Kim-Schulze, J. Fang, R. D. Favera, R. Cortesini, N. Suciu-Foca. 2004. Overlap between molecular markers expressed by naturally occurring CD4⁺CD25⁺ regulatory T cells and antigen specific CD4⁺CD25⁺ and CD8⁺CD28^– T suppressor cells. Hum. Immunol. 65: 1297-1306. [Medline]
23. Vlad, G., R. Cortesini, N. Suciu-Foca. 2005. License to heal: bidirectional interaction of antigen-specific regulatory T cells and tolerogenic APC. J. Immunol. 174: 5907-5914. [Abstract/Free Full Text]
24. Chambers, C. A., M. S. Kuhns, J. G. Egen, J. P. Allison. 2001. CTLA-4-mediated inhibition in regulation of T cell responses: mechanisms and manipulation in tumor immunotherapy. Annu. Rev. Immunol. 19: 565-594. [Medline]
25. Salomon, B., J. A. Bluestone. 2001. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu. Rev. Immunol. 19: 225-252. [Medline]
26. Watanabe, M., Y. Hara, K. Tanabe, H. Toma, R. Abe. 2005. A distinct role for ICOS-mediated co-stimulatory signaling in CD4⁺ and CD8⁺ T cell subsets. Int. Immunol. 17: 269-278. [Abstract/Free Full Text]
27. Lanzavecchia, A.. 1998. Immunology: licence to kill. Nature 393: 413-414. [Medline]
28. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4⁺ T-helper and a T-killer cell. Nature 393: 474-478. [Medline]
29. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 393: 478-480. [Medline]
30. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393: 480-483. [Medline]
31. Kojima, H., Y. Kanno, H. Hase, T. Kobata. 2005. CD4⁺CD25⁺ regulatory T cells attenuate the phosphatidylinositol 3-kinase/Akt pathway in antigen-primed immature CD8⁺ CTLs during functional maturation. J. Immunol. 174: 5959-5967. [Abstract/Free Full Text]
32. Penna, G., A. Roncari, S. Amuchastegui, K. C. Daniel, E. Berti, M. Colonna, L. Adorini. 2005. Expression of the inhibitory receptor ILT3 on dendritic cells is dispensable for induction of CD4⁺Foxp3⁺ regulatory T cells by 1,25-dihydroxyvitamin D3. Blood 106: 3490-3497. [Abstract/Free Full Text]
33. Adorini, L., N. Giarratana, G. Penna. 2004. Pharmacological induction of tolerogenic dendritic cells and regulatory T cells. Semin. Immunol. 16: 127-134. [Medline]
34. Penna, G., L. Adorini. 2000. 1 ,25-Dihydroxyvitamin D3 inhibits differentiation, maturation, activation, and survival of dendritic cells leading to impaired alloreactive T cell activation. J. Immunol. 164: 2405-2411. [Abstract/Free Full Text]
35. Adorini, L.. 2003. Tolerogenic dendritic cells induced by vitamin D receptor ligands enhance regulatory T cells inhibiting autoimmune diabetes. Ann. NY Acad. Sci. 987: 258-261. [Medline]
36. Levings, M. K., S. Gregori, E. Tresoldi, S. Cazzaniga, C. Bonini, M. G. Roncarolo. 2005. Differentiation of Tr1 cells by immature dendritic cells requires IL-10 but not CD25⁺CD4⁺ Tr cells. Blood 105: 1162-1169. [Abstract/Free Full Text]
37. Kirk, A. D., D. M. Harlan, N. N. Armstrong, T. A. Davis, Y. Dong, G. S. Gray, X. Hong, D. Thomas, J. H. Fechner, Jr, S. J. Knechtle. 1997. CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc. Natl. Acad. Sci. USA 94: 8789-8794. [Abstract/Free Full Text]
38. Levisetti, M. G., P. A. Padrid, G. L. Szot, N. Mittal, S. M. Meehan, C. L. Wardrip, G. S. Gray, D. S. Bruce, J. R. Thistlethwaite, Jr, J. A. Bluestone. 1997. Immunosuppressive effects of human CTLA4Ig in a non-human primate model of allogeneic pancreatic islet transplantation. J. Immunol. 159: 5187-5191. [Abstract]
39. Xu, H., S. P. Montgomery, E. H. Preston, D. K. Tadaki, D. A. Hale, D. M. Harlan, A. D. Kirk. 2003. Studies investigating pretransplant donor-specific blood transfusion, rapamycin, and the CD154-specific antibody IDEC-131 in a nonhuman primate model of skin allotransplantation. J. Immunol. 170: 2776-2782. [Abstract/Free Full Text]
40. Kenyon, N. S., M. Chatzipetrou, M. Masetti, A. Ranuncoli, M. Oliveira, J. L. Wagner, A. D. Kirk, D. M. Harlan, L. C. Burkly, C. Ricordi. 1999. Long-term survival and function of intrahepatic islet allografts in rhesus monkeys treated with humanized anti-CD154. Proc. Natl. Acad. Sci. USA 96: 8132-8137. [Abstract/Free Full Text]
41. Montgomery, S. P., H. Xu, D. K. Tadaki, A. Celniker, L. C. Burkly, J. D. Berning, F. Cruzata, E. A. Elster, G. Gray, R. L. Kampen, et al 2002. Combination induction therapy with monoclonal antibodies specific for CD80, CD86, and CD154 in nonhuman primate renal transplantation. Transplantation 74: 1365-1369. [Medline]
42. Preston, E. H., H. Xu, K. K. Dhanireddy, J. P. Pearl, F. V. Leopardi, M. F. Starost, D. A. Hale, A. D. Kirk. 2005. IDEC-131 (anti-CD154), sirolimus and donor-specific transfusion facilitate operational tolerance in non-human primates. Am. J. Transplant. 5: 1032-1041. [Medline]
43. Pierson, R. N., J. E. Crowe 3rd, Jr, S. Pfeiffer, J. Atkinson, A. Azimzadeh, G. G. Miller. 2001. CD40-ligand in primate cardiac allograft and viral immunity. Immunol. Res. 23: 253-262. [Medline]
44. Larsen, C. P., T. C. Pearson, A. B. Adams, P. Tso, N. Shirasugi, E. Strobertm, D. Anderson, S. Cowan, K. Price, J. Naemura, et al 2005. Rational development of LEA29Y (belatacept), a high-affinity variant of CTLA4-Ig with potent immunosuppressive properties. Am. J. Transplant. 5: 443-453. [Medline]

This article has been cited by other articles:

				M. Brenk, M. Scheler, S. Koch, J. Neumann, O. Takikawa, G. Hacker, T. Bieber, and D. von Bubnoff Tryptophan Deprivation Induces Inhibitory Receptors ILT3 and ILT4 on Dendritic Cells Favoring the Induction of Human CD4+CD25+ Foxp3+ T Regulatory Cells J. Immunol., July 1, 2009; 183(1): 145 - 154. [Abstract] [Full Text] [PDF]

				C.-C. Chang, Z. Liu, G. Vlad, H. Qin, X. Qiao, D. M. Mancini, C. C. Marboe, R. Cortesini, and N. Suciu-Foca Ig-Like Transcript 3 Regulates Expression of Proinflammatory Cytokines and Migration of Activated T Cells J. Immunol., May 1, 2009; 182(9): 5208 - 5216. [Abstract] [Full Text] [PDF]

				G. Vlad, V. D. D'Agati, Q.-Y. Zhang, Z. Liu, E. K. Ho, T. Mohanakumar, M. A. Hardy, R. Cortesini, and N. Suciu-Foca Immunoglobulin-Like Transcript 3-Fc Suppresses T-Cell Responses to Allogeneic Human Islet Transplants in hu-NOD/SCID Mice Diabetes, July 1, 2008; 57(7): 1878 - 1886. [Abstract] [Full Text] [PDF]

				N. T. Young, E. C. P. Waller, R. Patel, A. Roghanian, J. M. Austyn, and J. Trowsdale The inhibitory receptor LILRB1 modulates the differentiation and regulatory potential of human dendritic cells Blood, March 15, 2008; 111(6): 3090 - 3096. [Abstract] [Full Text] [PDF]

				N. Tedla, C.-W. Lee, L. Borges, C. L. Geczy, and J. P. Arm Differential expression of leukocyte immunoglobulin-like receptors on cord blood-derived human mast cell progenitors and mature mast cells J. Leukoc. Biol., February 1, 2008; 83(2): 334 - 343. [Abstract] [Full Text] [PDF]

				N. Suciu-Foca, N. Feirt, Q.-Y. Zhang, G. Vlad, Z. Liu, H. Lin, C.-C. Chang, E. K. Ho, A. I. Colovai, H. Kaufman, et al. Soluble Ig-Like Transcript 3 Inhibits Tumor Allograft Rejection in Humanized SCID Mice and T Cell Responses in Cancer Patients J. Immunol., June 1, 2007; 178(11): 7432 - 7441. [Abstract] [Full Text] [PDF]

				M. Shiroishi, M. Kajikawa, K. Kuroki, T. Ose, D. Kohda, and K. Maenaka Crystal Structure of the Human Monocyte-activating Receptor, "Group 2" Leukocyte Ig-like Receptor A5 (LILRA5/LIR9/ILT11) J. Biol. Chem., July 14, 2006; 281(28): 19536 - 19544. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim-Schulze, S. Articles by Suciu-Foca, N. Search for Related Content PubMed PubMed Citation Articles by Kim-Schulze, S. Articles by Suciu-Foca, N. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene