The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sirén, J.
Right arrow Articles by Matikainen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sirén, J.
Right arrow Articles by Matikainen, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2005, 174: 1932-1937.
Copyright © 2005 by The American Association of Immunologists

IFN-{alpha} Regulates TLR-Dependent Gene Expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-291

Jukka Sirén2, Jaana Pirhonen, Ilkka Julkunen and Sampsa Matikainen

Department of Microbiology, National Public Health Institute, Helsinki, Finland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Toll-like receptors (TLRs) mediate host cell activation by various microbial components. TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 are the receptors that have been associated with virus-induced immune response. We have previously reported that all these TLRs, except TLR9, are expressed at mRNA levels in human monocyte-derived macrophages. Here we have studied TLR2, TLR3, TLR4, and TLR7/8 ligand-induced IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 expression in human macrophages. IFN-{alpha} pretreatment of macrophages was required for efficient TLR3 and TLR4 agonist-induced activation of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 genes. TLR7/8 agonist weakly activated IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 genes, whereas TLR2 agonist was not able to activate these genes. IFN-{alpha} enhanced TLR responsiveness in macrophages by up-regulating the expression of TLR3, TLR4, and TLR7. IFN-{alpha} also enhanced the expression of TLR signaling molecules MyD88, TIR domain-containing adaptor inducing IFN-{beta}, I{kappa}B kinase-{epsilon}, receptor interacting protein 1, and IFN regulatory factor 7. Furthermore, the activation of transcription factor IFN regulatory factor 3 by TLR3 and TLR4 agonists was dependent on IFN-{alpha} pretreatment. In conclusion, our results suggest that IFN-{alpha} sensitizes cells to microbial recognition by up-regulating the expression of several TLRs as well as adapter molecules and kinases involved in TLR signaling.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mammalian innate immune system detects invading pathogens via TLRs. These pattern recognition receptors are expressed on professional APCs, such as macrophages and dendritic cells. TLRs detect conserved microbial components and activate intracellular signaling cascades leading to the expression of several cytokine and chemokine genes. To date, 13 mammalian TLRs have been characterized (1). The vast majority of TLR research has focused on bacterial recognition by TLRs. Less is known about viruses and TLRs, albeit the fact that during virus-infections the rapid response of innate immune system, particularly production of type I IFNs, is essential for the clearance of viral pathogens. TLRs associated with antiviral immunity include TLR4, which has been reported to recognize the fusion protein of respiratory syncytial virus (2) and TLR2 that has been shown to mediate recognition of measles virus and HSV (3, 4). Similarly, TLR9 mediates recognition of HSV DNA in plasmacytoid dendritic cells (5, 6). In addition, TLR3 is a receptor for dsRNA (7) that is formed during the replication of many RNA viruses. TLR7/8 was initially found to recognize small synthetic antiviral compounds, imidazoquinolines (8, 9). Therefore, it was assumed that TLR7/8 is involved in virus-induced immune responses. Recently TLR7/8 was reported to mediate recognition of viral ssRNA (10, 11, 12). Therefore, TLR3, TLR7, and TLR8 constitute a powerful system to detect viral genetic material.

TLR signaling is mediated by adapter proteins and protein kinases, ultimately leading to the activation of IFN regulatory factor (IRF)3 and NF-{kappa}B family of transcription factors and subsequent induction of TLR-regulated genes. The TLR signal transduction pathways are activated when the cytoplasmic Toll/IL-1 receptor (TIR) domain of TLRs recruits cytosolic TIR-domain containing adapter molecules to the receptor complex (13). Most TLRs utilize a common adaptor molecule MyD88 that mediates the activation of NF-{kappa}B and AP-1. However, TLR3 and TLR4 use other adaptor molecules as well, since their ligands induce IFN-{beta} expression independently of MyD88 (14, 15). Recently, it was shown that TIR domain-containing adaptor inducing IFN-{beta} (TRIF) mediates signal transduction downstream of TLR3 and TLR4 (16, 17, 18, 19). The hierarchy of TRIF-dependent signaling needs further elucidation, but it is known that TRIF mediates the activation of both IRF3 and NF-{kappa}B. TRIF associates with IRF3-activating I{kappa}B kinase-{epsilon} (IKK{epsilon}) and TANK-binding kinase-1 (TBK1) (20) and the disruption of these genes in mice results in defective TLR3- and TLR4-mediated IFN responses (16, 21, 22). Furthermore, TLR3/TRIF-induced NF-{kappa}B activation is dependent on receptor interacting protein (RIP) kinases (23). Ultimately, the differences in TLR signaling are reflected to differences in TLR-activated gene expression.

Here we have studied TLR2, TLR3, TLR4, TLR7/8 agonists-induced expression of IFN-{alpha}, IFN-{beta}, and novel type I IFN homologues, IL-28 (IFN-{lambda}2/3) and IL-29 (IFN-{lambda}1) (24, 25) in human monocyte-derived macrophages. We report that TLR3 and TLR4 ligand-induced IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 gene expression in macrophages is dependent on IFN-{alpha}. Our results suggest that IFN-{alpha}-dependent responsiveness to TLR triggering is achieved by IFN-{alpha}-regulated expression of TLRs and TLR-specific signaling components.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Macrophages and NK-92 cells

Human macrophages were obtained from leukocyte-rich buffy coats from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). PBMCs were isolated from buffy coats by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech). Monocytes were allowed to adhere to plastic six-well plates (Falcon Multiwell; BD Biosciences) and differentiated into macrophages for 1 wk in macrophage serum-free medium (Invitrogen Life Technologies) supplemented with GM-CSF (10 ng/ml; Nordic Biosite), 0.6 µg/ml penicillin and 60 µg/ml streptomycin. In all experiments, cells from four different blood donors were used. Human NK-92 cell line was obtained from American Type Culture Collection (ATCC CRL-2407) and maintained in continuous culture in MEM {alpha} medium supplemented with 12% horse serum (Invitrogen Life Technologies), 12% FCS (Integro), 0.2 mM i-inositol, 20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml IL-2 (Chiron). Before stimulation, NK-92 cells were starved in IL-2-free RPMI 1640 media for 18 h. All experiments were performed three times with similar results.

Cytokines and TLR ligands

Human leukocyte IFN-{alpha} was provided by the Finnish Red Cross Blood Transfusion Service and was used at 100 IU/ml. IFN-{beta} (Schering-Plough) was used at 100 IU/ml. TLR3 ligand poly(I:C) (Sigma-Aldrich), TLR2 ligand Pam3Cys (EMC Microcollections), TLR4 ligand LPS (Escherichia coli 0111:B4; Sigma-Aldrich) and TLR7/8 ligand R848 (InVivoGen) were used at 30 µg/ml, 100 ng/ml, 1 µg/ml and 1 µg/ml, respectively. TLR stimulations were performed in RPMI 1640 medium containing 10% FCS.

RNA isolation and Northern blot analysis

Total cellular RNA was isolated with the RNeasy kit (Qiagen) according to the manufacturer’s instructions. Samples containing equal amounts of RNA (10 µg) were size fractioned on 1% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond; Amersham Biosciences) and hybridized with IFN-{alpha}2 (26), IFN-{beta} (27), IL-28, IL-29, MyD88 (28), TRIF, TRIF-related adaptor molecule (TRAM), IKK{epsilon}, TBK1, RIP1, IRF1 (26), IRF7, IFN-{gamma} (29), TLR3, TLR4, TLR7, or TLR8, (30) probes. Probes for IL-28, IL-29, TRIF, TRAM, IKK{epsilon}, TBK1, IRF7, and RIP1 were cloned from total cellular RNA obtained from Sendai virus-infected macrophages by RT-PCR using oligonucleotides GTCTCCACAGGATCCGCAGGCCTT and CAGCCAGGGGGATCCTTTTTTGGG (IL-28), GAAGGCCAGGGATCCCTTGGAAGA and GTGTCAGGTGGATCCAGGGTGGGT (IL-29), GAACAGGGATCCTATAACTTTGTGATCCTC and GTGGGGGGATCCGGTGTTGGCCACCTTCCT (TRIF), GGGCAAAGGGGATCCTTTCTCGGGGAA and GCACAGTGTGGATCCAAGTCCAGGATA (TRAM), TCAGACGGATCCAGGTGCTGGGACTCTAT and TACATGGGATCCGAAGCATCCAGCAGA (IKK{epsilon}), ATTGCAGGATCCGATTTACTATCAGTTC and CTAAAGGGATCCAACGTTGCGAAGGCCAC (TBK1), ATGATGGTCGGATCCAGCGCCCCTGGG and GCTCAGGCGGGATCCGTGCTGGCGAGA (IRF7), and AAAGAAAGAGGATCCAAACGAAAA and GCTGTTCCTGGATCCAGTGGTCTT (RIP1). To ensure equal RNA loading, {beta}-actin mRNA expression was analyzed. The probes were labeled with [{alpha}-32P]dATP (3000 Ci/mmol; Amersham Biosciences) using a random primed DNA labeling kit (Boehringer Mannheim). The membranes were hybridized (Ultrahyb; Ambion) and washed in 1x SSC/0.1% SDS and exposed to Kodak AR X-omat films at –70°C using intensifying screens.

Western blot analysis

Equal amounts of proteins were separated on SDS-PAGE with the Laemmli buffer system and transferred onto Immobilon-P membranes (Millipore). The membranes were blocked with PBS containing 5% nonfat milk and were stained with anti-TBK1 (SC-9085; Santa Cruz Biotechnology), anti-IKK{epsilon} (SC-9913), or anti-RIP1 (SC-7881) Abs followed by staining with peroxidase conjugated anti-rabbit or anti-goat IgG (DakoCytomation) and visualization with the ECL system (Amersham Biosciences).

Oligonucleotide DNA precipitation

Equal amounts of cells (1 x 107/sample) were harvested and nuclear extracts were prepared by lysing the cells in buffer containing 10 mM HEPES-KOH, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture (Complete; Roche). The remaining nuclei were lysed in 10 mM HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture. DNA binding proteins were incubated for 2 h with streptavidin-agarose beads (Pierce) coupled to 5'-biotinylated oligonucleotides: IFN-{alpha}14 positive regulatory domain (PRD)-like (GGATCCGGAAAGCCAAAAGAGAAGTAGAAAAAAA), IFN-{beta} PRDI-III (GGATCCCACTTTCACTTCTCCCTTTCAGTTTTC), and IFN-{beta} PRDII (GGATCCGGAATTTCCCGGAATTTCCC) (31, 32) (DNA Technology). The binding reactions were performed for 2 h at +4°C in binding buffer (10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture) followed by washing the unbound proteins with binding buffer. The oligonucleotide-bound proteins were released in SDS sample buffer, separated on SDS-PAGE, and transferred onto Immobilon-P membranes (Millipore). The proteins were visualized with the ECL system by using guinea pig anti-IRF-3 (IFN-{beta} PRDI-III precipitated), anti-IRF1, anti-IRF7 (IFN-{alpha}14 PRD-like precipitated), or rabbit anti-p50 (SC-7178; Santa Cruz Biotechnology), anti-p65 (SC-372), anti-c-rel (SC-70), anti-RelB (SC-226) (IFN-{beta} PRDII precipitated) Abs and peroxidase conjugated goat anti-rabbit or anti-guinea pig IgG (DakoCytomation). Guinea pig anti-IRF-1 Abs have been previously described (33). Anti-IRF3 and anti-IRF7 were prepared in guinea pigs by immunizing the animals four times at 4-wk intervals with preparative SDS-PAGE (BioRad) purified baculovirus-expressed proteins (20 µg per immunization).

Biological IFN-{alpha}{beta} assay

Cell culture supernatants were treated at pH 2, and IFN-{alpha}{beta} titer was measured in HEp2 cells by vesicular stomatitis virus plaque reduction assay as previously described (34). The results are shown as international units per milliliter, using IFN-{alpha} preparation as a standard.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{alpha} pretreatment enhances TLR- and virus-induced IFN gene expression

Type I IFNs are an essential factor in the activation of multiple genes during viral infections. TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 are associated with virus-induced immune response and antiviral immunity (35). Hence, we determined IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 mRNA expression in macrophages stimulated with TLR2, TLR3, TLR4, or TLR7/8 ligands Pam3Cys, poly(I:C), LPS, or R848, respectively. TLR9 ligand was not included in our studies since TLR9 gene was not found to be expressed in macrophages (data not shown). As shown in Fig. 1, IFN-{alpha} pretreatment of macrophages was required for efficient TLR3 and TLR4 ligand-induced IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 mRNA expression. TLR7/8 stimulation resulted in a weak induction of IFN genes in IFN-{alpha}-pretreated macrophages, whereas TLR2 ligand was not able to induce IFN mRNA expression, regardless of IFN-{alpha} pretreatment. These results demonstrate that TLR2, TLR3, TLR4, and TLR7/8 differ in their ability to induce IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 gene expression in human macrophages. Furthermore, IFN-{alpha} pretreatment was required for the TLR-actived expression of these genes.



View larger version (82K):
[in this window]
[in a new window]
 
FIGURE 1. IFN-{alpha} enhances TLR ligand-induced IFN production in human macrophages. Macrophages were stimulated with Pam3Cys (100 ng/ml), poly(I:C) (30 µg/ml), LPS (1 µg/ml), or R848 (1 µg/ml), ligands for TLR2, TLR3, TLR4, and TLR7/8, respectively. After 3 h, cells were collected and total cellular RNA was isolated and analyzed by Northern blotting. Where indicated, macrophages were pretreated with IFN-{alpha} (100 IU/ml) for 16 h before stimulations.

 
As IFN-{alpha} positively regulated TLR-mediated IFN production in human macrophages, we determined whether virus-induced IFN production was also enhanced by IFN-{alpha} pretreatment (Fig. 2). Both influenza A and Sendai virus-infected human macrophages are known to produce type I IFNs (36, 37). Sendai virus activated high IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 mRNA expression in macrophages, which was further enhanced by IFN-{alpha} pretreatment. Densitometric scanning with image analysis software (Kodak Digital Science) showed that IFN-{alpha} enhances Sendai virus-induced IFN gene expression in macrophages by ~2-fold. Similar to TLR3 ligand, influenza A virus-induced IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 gene expression was strongly enhanced by IFN-{alpha} pretreatment (Fig. 2).



View larger version (76K):
[in this window]
[in a new window]
 
FIGURE 2. Virus-induced IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 expression is enhanced in human macrophages by IFN-{alpha}. Macrophages were infected with influenza A (12.8 hemagglutinating units/ml) or Sendai (20 hemagglutinating units/ml) virus or stimulated with poly(I:C) (30 µg/ml). After 8 h, cells were collected and analyzed by Northern blotting. Where indicated, macrophages were pretreated with IFN-{alpha} (100 IU/ml) for 16 h before stimulations.

 
IFN-{alpha} enhances expression of TLRs and TLR signaling molecules

TLR signaling leads to the activation of NF-{kappa}B and IRF families of transcription factors. To date, five potential TIR domain-containing TLR adaptor molecules have been identified (38). Since IFN-{alpha} enhanced TLR-activated IFN production in macrophages, we studied whether IFN-{alpha} affected the expression of TLRs and TLR signaling molecules. TLR3, TLR4, and TLR7 mRNA expression was clearly enhanced by IFN-{alpha} (Fig. 3). This confirms our previous observations that IFN-{alpha} regulates TLR gene expression in macrophages (30). IFN-{alpha} also up-regulated mRNA expression of MyD88, a common adaptor molecule associated with TLR signaling (Fig. 4A). However, TLR3 and TLR4 signal MyD88-independently via another adaptor molecule TRIF, leading to the activation of IRF3 and NF-{kappa}B (16, 17, 19). TRIF mRNA expression was up-regulated in macrophages by IFN-{alpha}. TRIF mediates TLR4-specific, MyD88-independent gene expression with TRAM (18, 39). TRAM gene expression was not affected by IFN-{alpha}.



View larger version (98K):
[in this window]
[in a new window]
 
FIGURE 3. IFN-{alpha} regulates TLR gene expression in human macrophages. Macrophages were stimulated with IFN-{alpha} (100 IU/ml) for different periods of time. Cells were collected and total cellular RNA was isolated and analyzed by Northern blotting.

 


View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of TLR signaling molecules in IFN-{alpha}-treated macrophages. A, Macrophages were stimulated with IFN-{alpha} (100 IU/ml) and analyzed by Northern blotting with indicated cDNA probes. B, IKK{epsilon}, TBK1, and RIP1 protein expression was analyzed by Western blotting in IFN-{alpha} or IFN-{beta} (100 IU/ml) treated macrophages.

 
TRIF is reported to associate with IRF3 and IRF7 activating kinases, TBK1 and IKK{epsilon} (20, 40). Since the activation of IRF family of transcription factors is essential for IFN-{alpha} and IFN-{beta} production, we analyzed the expression of IRFs, TBK1 and IKK{epsilon} in macrophages. TBK1 and IKK{epsilon} are basally expressed in macrophages (Fig. 4, A and B). IKK{epsilon} mRNA and protein expression was clearly up-regulated in response to IFN-{alpha} stimulation, whereas only a modest increase in TBK1 mRNA and protein expression was observed. IFN-{alpha} does not affect IRF3 gene expression (41), whereas IRF1 and IRF7 gene expression was activated by IFN-{alpha} treatment (Fig. 4A). RIP1 is a TLR3/TRIF-specific mediator of NF-{kappa}B activation (23). RIP1 mRNA and protein expression was also strongly enhanced by IFN-{alpha} (Fig. 4, A and B). We conclude that besides stimulating the expression of TLR3 and TLR4, IFN-{alpha} regulates TLR-mediated gene activation in macrophages by enhancing the expression of TLR3- and TLR4-specific signaling molecules.

TLR ligand-induced IRF and NF-{kappa}B activation

To gain more insight into TLR3-, TLR4-, TLR7-, and TLR8-regulated IFN induction in human macrophages, we studied the activation of the IRF family of transcription factors in TLR3, TLR4, and TLR7/8 ligand-stimulated macrophages. Nuclear extracts from TLR ligand-stimulated cells were precipitated with oligonucleotides containing an IRF binding site from IFN-{alpha} or IFN-{beta} genes. Oligonucleotide-bound transcription factors were analyzed by Western blotting (Fig. 5A). Basal IRF3 DNA binding to IFN-{beta} promoter PRDI-PRDIII region was detected in untreated macrophages. Both TLR3 and TLR4 ligands induced the phosphorylation of IRF3, and this phosphorylation was clearly higher in TLR3/4-stimulated cells that were pretreated with IFN-{alpha}. No IRF7 DNA binding to IFN-{alpha}14 PRD-like element was observed in untreated macrophages. However, enhanced IRF7 DNA binding was detected in IFN-{alpha} pretreated cells, and this binding was clearly increased by TLR3 and TLR4 stimulation. IRF1 DNA binding to IFN-{alpha}14 PRD-like element was also activated by TLR3 and TLR4 ligands. As in the case of IRF7, clearly stronger binding of IRF1 was observed in cells pretreated with IFN-{alpha}. Interestingly, TLR7/8 ligand R848 activated IRF1 DNA binding to IFN-{alpha}14 PRD-like element, but no significant IRF3 phosphorylation or IRF7 DNA binding was seen. In contrast, R848 weakly inhibited IRF3 and IFN-{alpha}-induced IRF7 DNA binding.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. TLR3, TLR7/8, and TLR4 ligand-mediated IRF and NF-{kappa}B activation is differentially regulated in IFN-{alpha} pretreated macrophages. Macrophages were stimulated with poly(I:C) (30 µg/ml), R848 (1 µg/ml), or LPS (1 µg/ml) for 3 h. A, The cells were collected and proteins in nuclear extracts were precipitated with IFN-{alpha}14 promoter PRD-like region (IRF1 and IRF7) or IFN-{beta} promoter PRDI-PRDIII region (IRF3) containing oligonucleotides. B, Proteins in nuclear extracts were precipitated with IFN-{beta} promoter PRDII (NF-{kappa}B) region containing oligonucleotide. The precipitated proteins were analyzed by Western blotting. Where indicated macrophages were pretreated with IFN-{alpha} (100 IU/ml) for 16 h before stimulations with TLR ligands.

 
In addition to IRFs, NF-{kappa}B transcription factors regulate type I IFN gene expression. We studied the effect of TLR stimulation to NF-{kappa}B DNA binding activity with oligonucleotide immunoprecipitation method. TLR3, TLR4, and TLR7/8 ligands enhanced p50, p65, c-rel, and RelB DNA binding to IFN-{beta} promoter PRDII element (Fig. 5B). IFN-{alpha} pretreatment as such enhanced the DNA binding of NF-{kappa}B p65 protein. TLR3 ligand-induced p65 DNA binding was clearly enhanced in IFN-{alpha}-pretreated cells. In conclusion, our results show that especially TLR3 ligand-induced IRF3 and NF-{kappa}B activation and TLR4 ligand-induced IRF3 activation were enhanced in IFN-{alpha}-pretreated cells.

Cell culture supernatants from TLR3, TLR4, and TLR7/8 ligand-stimulated macrophages have antiviral and IFN-{gamma}-inducing activity

IFN-{alpha} has been shown to induce IFN-{gamma} production from NK and T cells (37, 42, 43). We determined the IFN-{gamma}-inducing activity of cell culture supernatants from TLR ligand-stimulated macrophages. Macrophages were stimulated with TLR2, TLR3, TLR4, and TLR7/8 ligands for 20 h, after which the macrophage cell culture supernatants were collected and subjected onto NK-92 cells. After 3 h of stimulation with macrophage supernatants, NK-92 cells were harvested and their IFN-{gamma} mRNA expression was analyzed by Northern blotting (Fig. 6A). Supernatants from TLR3 and TLR4 ligand-stimulated macrophages induced IFN-{gamma} gene expression in NK-92 cells only when macrophages had been pretreated with IFN-{alpha}. This demonstrates the importance of IFN-{alpha} in sensitizing the macrophages for TLR3 and TLR4 signaling.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 6. Cell-culture supernatants from TLR3, TLR7/8, or TLR4 ligand-stimulated macrophages have antiviral and IFN-{gamma}-inducing activity. IFN-{alpha} (100 IU/ml) pretreated or untreated macrophages were stimulated with poly(I:C) (30 µg/ml), R848 (1 µg/ml), Pam3Cys (100 ng/ml), or LPS (1 µg/ml) for 20 h, and cell culture supernatants were collected. A, Supernatants were subjected onto NK-92 cells, and IFN-{gamma} expression in NK-92 cells was analyzed by Northern blotting. B, The IFN titers in macrophage culture supernatants were analyzed by a biological type I IFN assay.

 
Macrophage supernatants (from Fig. 6A) were also analyzed for their antiviral activity. This was done with a biological type I IFN assay that is based on vesicular stomatitis virus plaque reduction. IFN-{alpha} pretreatment was absolutely required for TLR3 and TLR4 ligand-induced antiviral activity (Fig. 6B). Supernatants from TLR2 ligand-treated macrophages had neither antiviral nor IFN-{gamma} inducing activity. These results correlate well with IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 mRNA expression patterns presented in Fig. 1. Cell culture supernatants from TLR7/8 ligand-stimulated macrophages had both antiviral and IFN-{gamma}-inducing activity (Fig. 6, A and B). Thus, despite hardly detectable IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 mRNA expression by Northern blotting (Fig. 1), TLR7/8 triggering as such enhances the production of antiviral cytokines in macrophages.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During viral infections rapid production of IFNs is needed to prevent the spread of the viruses within the organism. In addition to their direct antiviral effects IFNs regulate both innate and adaptive immunity. Recently, a novel family of type I IFN-like cytokines was described (24, 25). IL-28A/B and IL-29 (also known as IFN-{lambda}2/3 and IFN-{lambda}1, respectively), posses antiviral activity and their production is induced by viral infection in several cell types (24, 25, 44). There is evidence that virus infection-induced cytokine production is mediated throught TLRs (45). In this report we have examined the involvement of TLRs in IFN gene expression, by using agonists for those TLRs, that have been associated with RNA virus infections. We show that these TLRs selectively mediate IFN gene expression in human monocyte-derived primary macrophages. In addition, we provide evidence that IFN-{alpha} sensitizes the cells to microbial stimulation by up-regulating the expression of TLRs and various adaptor molecules and kinases involved in TLR signaling.

It has been well established that several IFN-{alpha} genes are regulated by a positive feedback mechanism by type I IFN-induced IRF7 during virus infection (46). In addition, type I IFNs are essential for TLR3- and TLR4-induced gene activation (14, 47, 48, 49, 50). In our study, TLR3 and TLR4 ligand-induced IFN-{alpha} and IFN-{beta} gene expression was strongly enhanced by IFN-{alpha} pretreatment of macrophages. Similarly, IL-28 and IL-29 expression was induced by TLR3 and TLR4 stimulation and their expression, too, was dramatically enhanced when macrophages were pretreated with IFN-{alpha}. Thus, the positive feedback loop associated with IFN-{alpha} and IFN-{beta} induction (51, 52, 53) is also involved in the regulation of IL-28 and IL-29 gene expression. TLR7/8 ligand induced a weak expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 genes in IFN-{alpha}-pretreated macrophages whereas TLR2 ligand was completely unable to activate these genes. In conclusion, our results suggest that IL-28 and IL-29 genes are regulated in similar fashion as IFN-{alpha} and IFN-{beta} genes.

TLR signal transduction is regulated by adaptor proteins acting downstream of TLRs, resulting in the activation of NF-{kappa}B and IRF family of transcription factors (13). TLR3 and TLR4 are unique among TLRs since they are capable of mediating MyD88-independent NF-{kappa}B and IRF3 activation via TRIF (16, 17, 18). Both MyD88 and TRIF expression in human macrophages was enhanced by IFN-{alpha} (Fig. 4). In addition to our previously described activation of TLR3 gene expression (30), IFN-{alpha} up-regulated expression of TLR4 in macrophages. Therefore, the essential components involved in TLR3- and TLR4-mediated intracellular signaling pathways are up-regulated by IFN-{alpha}, giving a putative molecular explanation for the enhanced responsiveness of macrophages to TLR3 and TLR4 triggering after IFN-{alpha} stimulation.

Type I IFN gene expression is tightly regulated by transcription factors belonging to the NF-{kappa}B and IRF families. Upon appropriate signals, IRF3 and NF-{kappa}B are activated and transported into the nucleus where they regulate IFN-{alpha} and IFN-{beta} gene expression. The first wave of IFN-{alpha} and/or IFN-{beta} produced stimulates IRF7 expression, which activates the expression of most IFN-{alpha} subtype genes (51, 52, 53). Thus, IRF7 is considered to be one of the key regulators of type I IFN production. Our knowledge of molecular mechanisms that regulate virus infection-induced or TLR-mediated activation of IRF3 and IRF7 was greatly improved when TBK1 and IKK{epsilon} were identified to be IRF3- and IRF7-activating kinases (20, 40). In addition, it was recently shown that a serine-threonine kinase, RIP1, mediates TLR3/TRIF-specific NF-{kappa}B activation (23). In macrophages IKK{epsilon} and especially RIP1 mRNA and protein expressions were clearly enhanced by IFN-{alpha} stimulation. Up-regulation of RIP1 and IKK{epsilon} expression is likely to contribute to enhanced NF-{kappa}B and IRF3 activation, respectively, which we observed after TLR3 stimulation in IFN-{alpha}-pretreated macrophages. RIP1 is specifically involved in TLR3/TRIF signaling pathway and, therefore, it is conceivable that the observed up-regulation of RIP1 gene expression by IFN-{alpha} does not affect TLR4 ligand-induced NF-{kappa}B activation. However, IFN-{alpha} pretreatment strongly enhanced TLR4 ligand-induced IRF3 activation and this likely explains the increased IFN-{beta} gene expression in these cells.

TLR7 and TLR8 recognize viral ssRNA (10, 11, 12) and, therefore, they can be considered as crucial receptors recognizing the genetic material of RNA viruses. TLR7/8-specific ligand, R848 induces IFN-{alpha} or IL-12 production in human myeloid or plasmacytoid DCs, respectively (54). This demonstrates that TLR7 and TLR8 mediate their effects in a cell type-specific manner. Although R848 did not stimulate significant IFN-{alpha}1, IFN-{alpha}2, IFN-{alpha}4, IFN-{beta}, IFN-{omega}, IL-28, or IL-29 mRNA expression in macrophages (Fig. 1 and data not shown), it was able to induce type I IFN-like antiviral activity especially in cells that were pretreated with IFN-{alpha}. This suggests that TLR7/8 ligand-induced gene expression in human macrophages should be by DNA microarray analysis.

In addition to IFNs, TLR triggering induces the production of a variety of chemotactic and immunomodulatory cytokines that regulate the activation of immune cells. IFN-{gamma} is essential for the development of Th1 type immune response. Cell culture supernatants from TLR3 or TLR4 ligand-stimulated macrophages induced IFN-{gamma} gene expression in NK cells only when macrophages were pretreated with IFN-{alpha} (Fig. 6). These results suggest that IFN-{alpha} may significantly contribute to TLR-induced development of Th1 immune response.

In this report we demonstrated that TLRs involved in the recognition of different viral components differentially activate antiviral response in human monocyte-derived macrophages. In addition, our results demonstrate the crucial role of IFN-{alpha} in enhancing the innate immune sensing.


    Acknowledgments
 
We thank Hanna Valtonen, Mari Aaltonen, and Teija Westerlund for expert technical assistance.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Medical Research Council of the Academy of Finland, The Sigrid Juselius foundation, and the Finnish Cancer Foundation. Back

2 Address correspondence and reprint requests to Dr. Jukka Sirén, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FI-00300 Helsinki, Finland. E-mail address: jukka.siren{at}ktl.fi Back

3 Abbreviations used in this paper: IRF, IFN regulatory factor; IKK{epsilon}, I{kappa}B kinase-{epsilon}; RIP, receptor interacting protein; TBK1, TANK-binding kinase-1; TRAM, TRIF-related adaptor molecule; TRIF, TIR domain-containing adaptor inducing IFN-{beta}; TIR, Toll/IL-1 receptor; PRD, positive regulatory domain. Back

Received for publication July 15, 2004. Accepted for publication November 8, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tabeta, K., P. Georgel, E. Janssen, X. Du, K. Hoebe, K. Crozat, S. Mudd, L. Shamel, S. Sovath, J. Goode, et al 2004. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proc. Natl. Acad. Sci. USA 101:3516.[Abstract/Free Full Text]
  2. Kurt-Jones, E. A., L. Popova, L. Kwinn, L. M. Haynes, L. P. Jones, R. A. Tripp, E. E. Walsh, M. W. Freeman, D. T. Golenbock, L. J. Anderson, R. W. Finberg. 2000. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat. Immunol. 1:398.[Medline]
  3. Bieback, K., E. Lien, I. M. Klagge, E. Avota, J. Schneider-Schaulies, W. P. Duprex, H. Wagner, C. J. Kirschning, V. Ter Meulen, S. Schneider-Schaulies. 2002. Hemagglutinin protein of wild-type measles virus activates Toll-like receptor 2 signaling. J. Virol. 76:8729.[Abstract/Free Full Text]
  4. Kurt-Jones, E. A., M. Chan, S. Zhou, J. Wang, G. Reed, R. Bronson, M. M. Arnold, D. M. Knipe, R. W. Finberg. 2004. Herpes simplex virus 1 interaction with Toll-like receptor 2 contributes to lethal encephalitis. Proc. Natl. Acad. Sci. USA 101:1315.[Abstract/Free Full Text]
  5. Krug, A., G. D. Luker, W. Barchet, D. A. Leib, S. Akira, M. Colonna. 2004. Herpes simplex virus type 1 activates murine natural interferon-producing cells through toll-like receptor 9. Blood 103:1433.[Abstract/Free Full Text]
  6. Lund, J., A. Sato, S. Akira, R. Medzhitov, A. Iwasaki. 2003. Toll-like receptor 9-mediated recognition of herpes simplex virus-2 by plasmacytoid dendritic cells. J. Exp. Med. 198:513.[Abstract/Free Full Text]
  7. Alexopoulou, L., A. C. Holt, R. Medzhitov, R. A. Flavell. 2001. Recognition of double-stranded RNA and activation of NF-{kappa}B by Toll-like receptor 3. Nature 413:732.[Medline]
  8. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, H. Tomizawa, K. Takeda, S. Akira. 2002. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Immunol. 3:196.[Medline]
  9. Jurk, M., F. Heil, J. Vollmer, C. Schetter, A. M. Krieg, H. Wagner, G. Lipford, S. Bauer. 2002. Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848. Nat. Immunol. 3:499.[Medline]
  10. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, E. S. C. Reis. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:1529.[Abstract/Free Full Text]
  11. Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, S. Bauer. 2004. Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8. Science 303:1526.[Abstract/Free Full Text]
  12. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale, A. Iwasaki, R. A. Flavell. 2004. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 101:5598.[Abstract/Free Full Text]
  13. Akira, S.. 2003. Toll-like receptor signaling. J. Biol. Chem. 278:38105.[Free Full Text]
  14. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-{beta}-induced STAT1{alpha}/{beta}-dependent gene expression in macrophages. Nat. Immunol. 3:392.[Medline]
  15. Kawai, T., O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 167:5887.[Abstract/Free Full Text]
  16. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. Science 301:640.[Abstract/Free Full Text]
  17. Yamamoto, M., S. Sato, K. Mori, K. Hoshino, O. Takeuchi, K. Takeda, S. Akira. 2002. Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-{beta} promoter in the Toll-like receptor signaling. J. Immunol. 169:6668.[Abstract/Free Full Text]
  18. Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, D. T. Golenbock. 2003. LPS-TLR4 signaling to IRF-3/7 and NF-{kappa}B involves the Toll adapters TRAM and TRIF. J. Exp. Med. 198:1043.[Abstract/Free Full Text]
  19. Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa, T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-{beta} induction. Nat. Immunol. 4:161.[Medline]
  20. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, T. Maniatis. 2003. IKK{epsilon} and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491.[Medline]
  21. Hemmi, H., O. Takeuchi, S. Sato, M. Yamamoto, T. Kaisho, H. Sanjo, T. Kawai, K. Hoshino, K. Takeda, S. Akira. 2004. The roles of two I{kappa}B kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J. Exp. Med. 199:1641.[Abstract/Free Full Text]
  22. Perry, A. K., E. K. Chow, J. B. Goodnough, W. C. Yeh, G. Cheng. 2004. Differential requirement for TANK-binding kinase-1 in type I interferon responses to Toll-like receptor activation and viral infection. J. Exp. Med. 199:1651.[Abstract/Free Full Text]
  23. Meylan, E., K. Burns, K. Hofmann, V. Blancheteau, F. Martinon, M. Kelliher, J. Tschopp. 2004. RIP1 is an essential mediator of Toll-like receptor 3-induced NF-{kappa}B activation. Nat. Immunol. 5:503.[Medline]
  24. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer, T. E. Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, et al 2003. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat. Immunol. 4:63.[Medline]
  25. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen, N. K. Shah, J. A. Langer, F. Sheikh, H. Dickensheets, R. P. Donnelly. 2003. IFN-{lambda}s mediate antiviral protection through a distinct class II cytokine receptor complex. Nat. Immunol. 4:69.[Medline]
  26. Ronni, T., T. Sareneva, J. Pirhonen, I. Julkunen. 1995. Activation of IFN-{alpha}, IFN-{gamma}, MxA, and IFN regulatory factor 1 genes in influenza A virus-infected human peripheral blood mononuclear cells. J. Immunol. 154:2764.[Abstract]
  27. Ronni, T., S. Matikainen, T. Sareneva, K. Melen, J. Pirhonen, P. Keskinen, I. Julkunen. 1997. Regulation of IFN-{alpha}/{beta}, MxA, 2',5'-oligoadenylate synthetase, and HLA gene expression in influenza A-infected human lung epithelial cells. J. Immunol. 158:2363.[Abstract]
  28. Bonnert, T. P., K. E. Garka, P. Parnet, G. Sonoda, J. R. Testa, J. E. Sims. 1997. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett. 402:81.[Medline]
  29. Sareneva, T., J. Pirhonen, K. Cantell, N. Kalkkinen, I. Julkunen. 1994. Role of N-glycosylation in the synthesis, dimerization and secretion of human interferon-{gamma}. Biochem. J. 303:831.
  30. Miettinen, M., T. Sareneva, I. Julkunen, S. Matikainen. 2001. IFNs activate Toll-like receptor gene expression in viral infections. Genes Immun. 2:349.[Medline]
  31. Lin, R., P. Genin, Y. Mamane, J. Hiscott. 2000. Selective DNA binding and association with the CREB binding protein coactivator contribute to differential activation of {alpha}/{beta} interferon genes by interferon regulatory factors 3 and 7. Mol. Cell Biol. 20:6342.[Abstract/Free Full Text]
  32. Garoufalis, E., I. Kwan, R. Lin, A. Mustafa, N. Pepin, A. Roulston, J. Lacoste, J. Hiscott. 1994. Viral induction of the human {beta} interferon promoter: modulation of transcription by NF-{kappa}B/rel proteins and interferon regulatory factors. J. Virol. 68:4707.[Abstract/Free Full Text]
  33. Matikainen, S., T. Ronni, M. Hurme, R. Pine, I. Julkunen. 1996. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood 88:114.[Abstract/Free Full Text]
  34. Cantell, K., S. Hirvonen, H. L. Kauppinen, N. Kalkkinen. 1991. Rapid production of interferon-{gamma} in uninduced human leukocyte suspensions. J. Interferon Res. 11:231.[Medline]
  35. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21:335.[Medline]
  36. Pirhonen, J., T. Sareneva, M. Kurimoto, I. Julkunen, S. Matikainen. 1999. Virus infection activates IL-1{beta} and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322.[Abstract/Free Full Text]
  37. Sareneva, T., S. Matikainen, M. Kurimoto, I. Julkunen. 1998. Influenza A virus-induced IFN-{alpha}/{beta} and IL-18 synergistically enhance IFN-{gamma} gene expression in human T cells. J. Immunol. 160:6032.[Abstract/Free Full Text]
  38. O’Neill, L. A., K. A. Fitzgerald, A. G. Bowie. 2003. The Toll-IL-1 receptor adaptor family grows to five members. Trends Immunol. 24:286.[Medline]
  39. Yamamoto, M., S. Sato, H. Hemmi, S. Uematsu, K. Hoshino, T. Kaisho, O. Takeuchi, K. Takeda, S. Akira. 2003. TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nat. Immunol. 4:1144.[Medline]
  40. Sharma, S., B. R. ten Oever, N. Grandvaux, G. P. Zhou, R. Lin, J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300:1148.[Abstract/Free Full Text]
  41. Au, W. C., P. A. Moore, W. Lowther, Y. T. Juang, P. M. Pitha. 1995. Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes. Proc. Natl. Acad. Sci. USA 92:11657.[Abstract/Free Full Text]
  42. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, I. Julkunen, T. Sareneva. 2001. IFN-{alpha} and IL-18 synergistically enhance IFN-{gamma} production in human NK cells: differential regulation of Stat4 activation and IFN-{gamma} gene expression by IFN-{alpha} and IL-12. Eur. J. Immunol. 31:2236.[Medline]
  43. Pirhonen, J., S. Matikainen, I. Julkunen. 2002. Regulation of virus-induced IL-12 and IL-23 expression in human macrophages. J. Immunol. 169:5673.[Abstract/Free Full Text]
  44. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande, G. Uze. 2004. Viral infection and Toll-like receptor agonists induce a differential expression of type I and {lambda} interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur. J. Immunol. 34:796.[Medline]
  45. Vaidya, S. A., G. Cheng. 2003. Toll-like receptors and innate antiviral responses. Curr. Opin. Immunol. 15:402.[Medline]
  46. Levy, D. E., I. Marie, E. Smith, A. Prakash. 2002. Enhancement and diversification of IFN induction by IRF-7-mediated positive feedback. J. Interferon Cytokine Res. 22:87.[Medline]
  47. Vadiveloo, P. K., H. Christopoulos, U. Novak, I. Kola, P. J. Hertzog, J. A. Hamilton. 2000. Type I interferons mediate the lipopolysaccharide induction of macrophage cyclin D2. J. Interferon Cytokine Res. 20:355.[Medline]
  48. Vadiveloo, P. K., G. Vairo, P. Hertzog, I. Kola, J. A. Hamilton. 2000. Role of type I interferons during macrophage activation by lipopolysaccharide. Cytokine 12:1639.[Medline]
  49. Honda, K., S. Sakaguchi, C. Nakajima, A. Watanabe, H. Yanai, M. Matsumoto, T. Ohteki, T. Kaisho, A. Takaoka, S. Akira, et al 2003. Selective contribution of IFN-{alpha}/{beta} signaling to the maturation of dendritic cells induced by double-stranded RNA or viral infection. Proc. Natl. Acad. Sci. USA 100:10872.[Abstract/Free Full Text]
  50. Hoebe, K., E. M. Janssen, S. O. Kim, L. Alexopoulou, R. A. Flavell, J. Han, B. Beutler. 2003. Upregulation of costimulatory molecules induced by lipopolysaccharide and double-stranded RNA occurs by Trif-dependent and Trif-independent pathways. Nat. Immunol. 4:1223.[Medline]
  51. Marie, I., J. E. Durbin, D. E. Levy. 1998. Differential viral induction of distinct interferon-{alpha} genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660.[Medline]
  52. Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi, N. Tanaka. 1998. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7. FEBS Lett. 441:106.[Medline]
  53. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, T. Taniguchi. 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-{alpha}/{beta} gene induction. Immunity 13:539.[Medline]
  54. Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki, H. Tomizawa, S. Akira, S. Fukuhara. 2002. Interferon-{alpha} and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. M. Petzke, A. Brooks, M. A. Krupna, D. Mordue, and I. Schwartz
Recognition of Borrelia burgdorferi, the Lyme Disease Spirochete, by TLR7 and TLR9 Induces a Type I IFN Response by Human Immune Cells
J. Immunol., October 15, 2009; 183(8): 5279 - 5292.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Li, X. Liu, Y. Zhou, and S. B. Su
Interferon-{lambda}s: the modulators of antivirus, antitumor, and immune responses
J. Leukoc. Biol., July 1, 2009; 86(1): 23 - 32.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Romieu-Mourez, M. Francois, M.-N. Boivin, M. Bouchentouf, D. E. Spaner, and J. Galipeau
Cytokine Modulation of TLR Expression and Activation in Mesenchymal Stromal Cells Leads to a Proinflammatory Phenotype
J. Immunol., June 15, 2009; 182(12): 7963 - 7973.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Richez, K. Yasuda, A. A. Watkins, S. Akira, R. Lafyatis, J. M. van Seventer, and I. R. Rifkin
TLR4 Ligands Induce IFN-{alpha} Production by Mouse Conventional Dendritic Cells and Human Monocytes after IFN-{beta} Priming
J. Immunol., January 15, 2009; 182(2): 820 - 828.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. Y. Lee, Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, et al.
TLR7-dependent and Fc{gamma}R-independent production of type I interferon in experimental mouse lupus
J. Exp. Med., December 22, 2008; 205(13): 2995 - 3006.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. N. Henning, A. K. Azad, K. V. L. Parsa, J. E. Crowther, S. Tridandapani, and L. S. Schlesinger
Pulmonary Surfactant Protein A Regulates TLR Expression and Activity in Human Macrophages
J. Immunol., June 15, 2008; 180(12): 7847 - 7858.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Wolk, K. Witte, E. Witte, S. Proesch, G. Schulze-Tanzil, K. Nasilowska, J. Thilo, K. Asadullah, W. Sterry, H.-D. Volk, et al.
Maturing dendritic cells are an important source of IL-29 and IL-20 that may cooperatively increase the innate immunity of keratinocytes
J. Leukoc. Biol., May 1, 2008; 83(5): 1181 - 1193.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Ank, M. B. Iversen, C. Bartholdy, P. Staeheli, R. Hartmann, U. B. Jensen, F. Dagnaes-Hansen, A. R. Thomsen, Z. Chen, H. Haugen, et al.
An Important Role for Type III Interferon (IFN-{lambda}/IL-28) in TLR-Induced Antiviral Activity
J. Immunol., February 15, 2008; 180(4): 2474 - 2485.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Sillanpaa, P. Kaukinen, K. Melen, and I. Julkunen
Hepatitis C virus proteins interfere with the activation of chemokine gene promoters and downregulate chemokine gene expression
J. Gen. Virol., February 1, 2008; 89(2): 432 - 443.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen
IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages
J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Niessner, M. S. Shin, O. Pryshchep, J. J. Goronzy, E. L. Chaikof, and C. M. Weyand
Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque
Circulation, October 30, 2007; 116(18): 2043 - 2052.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. I. Osterlund, T. E. Pietila, V. Veckman, S. V. Kotenko, and I. Julkunen
IFN Regulatory Factor Family Members Differentially Regulate the Expression of Type III IFN (IFN-{lambda}) Genes
J. Immunol., September 15, 2007; 179(6): 3434 - 3442.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. P. Bell, P. A. Svingen, M. K. Rahman, Y. Xiong, and W. A. Faubion Jr.
Forkhead Box P3 Regulates TLR10 Expression in Human T Regulatory Cells
J. Immunol., August 1, 2007; 179(3): 1893 - 1900.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Severa, M. E. Remoli, E. Giacomini, V. Annibali, V. Gafa, R. Lande, M. Tomai, M. Salvetti, and E. M. Coccia
Sensitization to TLR7 Agonist in IFN-beta-Preactivated Dendritic Cells
J. Immunol., May 15, 2007; 178(10): 6208 - 6216.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Weighardt, S. Kaiser-Moore, S. Schlautkotter, T. Rossmann-Bloeck, U. Schleicher, C. Bogdan, and B. Holzmann
Type I IFN Modulates Host Defense and Late Hyperinflammation in Septic Peritonitis
J. Immunol., October 15, 2006; 177(8): 5623 - 5630.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. N. Sharif, D. Sosic, C. V. Rothlin, E. Kelly, G. Lemke, E. N. Olson, and L. B. Ivashkiv
Twist mediates suppression of inflammation by type I IFNs and Axl
J. Exp. Med., August 7, 2006; 203(8): 1891 - 1901.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Sato, M. Ohtsuki, M. Hata, E. Kobayashi, and T. Murakami
Antitumor Activity of IFN-{lambda} in Murine Tumor Models.
J. Immunol., June 15, 2006; 176(12): 7686 - 7694.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
C. Cermelli, V. Cenacchi, F. Beretti, F. Pezzini, D. D. Luca, and E. Blasi
Human herpesvirus-6 dysregulates monocyte-mediated anticryptococcal defences
J. Med. Microbiol., June 1, 2006; 55(6): 695 - 702.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen
IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells
J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Eriksson, S. K. Meadows, S. Basu, T. F. Mselle, C. R. Wira, and C. L. Sentman
TLRs Mediate IFN-{gamma} Production by Human Uterine NK Cells in Endometrium
J. Immunol., May 15, 2006; 176(10): 6219 - 6224.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. Ank, H. West, C. Bartholdy, K. Eriksson, A. R. Thomsen, and S. R. Paludan
Lambda Interferon (IFN-{lambda}), a Type III IFN, Is Induced by Viruses and IFNs and Displays Potent Antiviral Activity against Select Virus Infections In Vivo
J. Virol., May 1, 2006; 80(9): 4501 - 4509.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. Melchjorsen, J. Siren, I. Julkunen, S. R. Paludan, and S. Matikainen
Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-{kappa}B and IRF-3.
J. Gen. Virol., May 1, 2006; 87(Pt 5): 1099 - 1108.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al.
Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression.
J. Virol., April 1, 2006; 80(7): 3515 - 3522.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Ziegler, S. Matikainen, E. Ronkko, P. Osterlund, M. Sillanpaa, J. Siren, R. Fagerlund, M. Immonen, K. Melen, and I. Julkunen
Severe Acute Respiratory Syndrome Coronavirus Fails To Activate Cytokine-Mediated Innate Immune Responses in Cultured Human Monocyte-Derived Dendritic Cells
J. Virol., November 1, 2005; 79(21): 13800 - 13805.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Melchjorsen, S. B. Jensen, L. Malmgaard, S. B. Rasmussen, F. Weber, A. G. Bowie, S. Matikainen, and S. R. Paludan
Activation of Innate Defense against a Paramyxovirus Is Mediated by RIG-I and TLR7 and TLR8 in a Cell-Type-Specific Manner
J. Virol., October 15, 2005; 79(20): 12944 - 12951.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen
Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells
J. Virol., August 1, 2005; 79(15): 9608 - 9617.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sirén, J.
Right arrow Articles by Matikainen, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sirén, J.
Right arrow Articles by Matikainen, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS